INTRODUCTION:

The term infertility is used when the ability to become pregnant is diminished or absent. It does not mean that the women are unable to have children but may require treatment or assistance to achieve the pregnancy¹.

Polycystic ovarian syndrome (PCOS) is a prevalent and complex endocrine condition that affects 5 to 20% of reproductive-age women and is a leading cause of hirsutism and infertility^2-4.

Most adolescent girls are not aware of PCOS. Many of them had an irregular menstrual cycle, and hirsutism, and a few with weight gain^5-11.

The studied markers LH, fetuin-A, sirtuin-1, auto-antibodies (AHA, AOA), and interleukins ILs (17, 23) levels were elevated significantly in the patients' group when compared with the control. These findings confirm the possibility that PCOS may be attributed to an autoimmune disease¹².

Physiologically, One of the most significant tasks of the hormones in the hypothalamic-pituitary-gonadal axis in females is to manage ovulation and implantation by managing the uterine and ovarian cycles. The positive feedback loop between estrogen and LH aids in ovarian and uterine follicle preparation¹³. The generation of GnRH is inhibited by a negative feedback loop of estrogen in the brain. Whereas, follistatin hormone inhibits Activin, a peripherally generated hormone that positively promotes GnRH generating cells. Follistatin affects FSH secretion mediated by activin¹⁴.

Fibrillins are glycoproteins that form the backbone of multifunctional microfibrils in both elastic and non-elastic extracellular matrices¹⁵. Decreased fibrillin-3 expression in the ovary's perifollicular stroma has been linked to the development of polycystic ovarian syndrome¹⁶.

On the other hand, IVF programs are originally designed to help women with tubal illness, but it is now the preferred treatment for male factor infertility, unexplained infertility, endometriosis, and ovarian dysfunction. The fertilized ovum grows into an embryo that is cultured in ideal conditions until day 2-5 following conception, when it is transferred to the woman's uterus, selecting the best embryos. Successful implantation requires an intricate succession of molecular and genetic interactions¹⁷.

MATERIALS AND METHODS:

Study design, sample size, and selection criteria:

The research was planned as a prospective study. A total of 28 infertile women undergoing assisted reproductive technologies (ART) were included in the study, a convenient sample. The selected 28 women were intentionally divided, according to the cause of infertility, into 14 infertile women with polycystic ovarian syndrome (PCOS) and 14 non-polycystic ovarian syndromes (Male factor) used as a control group. For each patient, measurement of fold Activin A, and Fibrillin-3 expression in blood was done on:

On the day of the ovum collection and after 14 days of the embryo transfer (ET).

Inclusion and Exclusion criteria:

Inclusion criteria:

Patients with PCOS and non-PCOS (male factor)

Exclusion criteria:

Patients with endometriosis, diminished ovarian reserves, and chromosomal abnormality

Primers:

The source of all primers used in this study was macrogen® (Korea). The name and sequence are given in table (1).

Table 1: The name, sequence, and product size of primers used in this study

Name of Primer

Sequence

Reference

Activin a

Act-F(GACATTGGAAGGAGGGCAGAA)

Act-R(GAAATCTCGAAGTGCAGCGTC)

Newly Designed

Fibrillin-3

Fib-F(TCTCAATGTCCCTGGCTCCTA)

Fib-F(CACGTTCTCGGCACATTCATC)

Newly Designed

RNA Extraction:

RNA was extracted according to the kit manufacturer's recommendations. RNA was quantified by Qubit 4.0

RT-qPCR protocol:

This is the main step in our project has been divided into two phases, the first is done through the synthesis of cDNA from RNA through a specific primer for algD, pelA, and 16S rRNA transcripts and a photo script cDNA synthesis kit. This procedure has been performed as recommended by the manufacturer, using the following program.

Table 2: The program for Real-Time PCR

Cycle Step	Temperature	Time	Cycles
Initial Denaturation	95°C	60 seconds	1
Denaturation Extension	95°C 60°C	15 seconds 30 seconds (+plate read)	40-45
Melt Curve	60-95°C	40 minutes	1

RESULTS:

The result was collected and analyzed by the Livak formula below.

Comparison of ACT A fold expression between study groups at ova pick up day:

Results of real-time PCR quantification of ACT A gene expression. The mean ΔCt value of ACT A for Non-PCOS women was 17.24±2.33 in the pregnant group at ova pick-up day. While it was 12.66±2.86 in the Non-pregnant group. And the mean ΔCt value of ACT A for PCOS women was 18.65±1.14, 14.20±2.66 in pregnant and Non -pregnant women respectively at ova pick-up day. The fold of gene expression in pregnant groups was high compared to the Non-pregnant group for both PCOS and Non-PCOS women, where the fold of gene expression was (22,20 ) for Non- PCOS, and PCOS women respectively, which refers to an increase in ACT A expression in pregnant compared to gene expression in Non-pregnant group for both PCOS and Non –PCOS women (Table 3).

Table 4: Comparison of ACT A fold expression between study groups on the day of ET

Characteristic	Pregnancy state	N.	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
			ET		OPU
			Mean±SD
Non-PCOS	Pregnancy	7	0.89^a± 16.32	N.S.	-0.17	1.125	0.125
(n =14)	Non- pregnancy	7	0.69^a±16.15	0.8818
PCOS	Pregnancy	7	0.66^a± 16.97	N.S.	1.64	0.32	2.125
(n =14)	Non- pregnancy	7	1.23^a± 18.61	0.371

Table 5: Comparison of FBN-3fold expression between study groups on the day of ova pick up

Characteristic	Pregnancy state	N.	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
			OPU		OPU
			Mean±SD
Non-PCOS	Pregnancy	7	15.50±2.07	0.6657	1.07	0.47	1.127
(n =14 )	Non- pregnancy	7	16.57±6.07
PCOS	Pregnancy	7	15.91±3.62	0.4473	2.14	0.22	3.54
(n = 14 )	Non- pregnancy	7	18.05±6.01

Table 6: Comparison of FIB-3fold expression between study groups on the day of ET

Characteristic	Pregnancy state	N.	ΔCT	P-value		2^{– ΔΔCT}	Fold of gene expression
			ET		ΔΔ CT
			Mean±SD		OPU
Non-PCOS	Pregnancy	7	13.52±5.31	0.7245	-0.9	1.86	0.86
(n =14)	Non- pregnancy	7	12.62±3.90
PCOS	Pregnancy	7	13.22±4.39	0.7409	-0.88	1.84	0.84
(n =14)	Non- pregnancy	7	12.34±4.92

Comparison of FBN-3 fold expression between study groups on the day of ova pick up:

The mean ΔCt value of FBN-3 for Non-PCOS women was15.50±2.07 in pregnant women at ova pick-up day. While it was 16.57±6.07in Non- pregnant, the mean ΔCt value of FBN-3 for PCOS women was 15.91±3.62, 18.05±6.01 in pregnant and Non -pregnant women on an ova pick-up day The fold of gene expression in pregnant group decreased by (1.127) compared to Non-pregnant group for Non- PCOS women, also for PCOS women the fold of gene expression decreased by (3.54) compared to Non-pregnant group (Table 5).

Comparison of FBN-3 fold expression between study groups on the day of ET:

Results of real-time PCR quantification of FBN-3 gene expression are shown in table (6). The mean ΔCt value of FBN-3 for Non-PCOS women was 13.52±5.31 in pregnant women after 14 days of embryo transfer. While it was 12.62±3.90 in non-pregnant. And the mean ΔCt value of FBN-3 for PCOS women was 13.22±4.39, and 12.34±4.92 in pregnant and Non -pregnant women respectively at ova pick-up day. The fold of gene expression in pregnant groups was high compared to the Non-pregnant group for both PCOS and Non-PCOS women, where the fold of gene expression was (0.86,0.84 ) for Non- PCOS, and PCOS women respectively, which refers to an increase in FBN-3expression in the pregnant group compared to gene expression in Non-pregnant group.

Comparison of ACT A expression between PCOS and Non-PCOS groups on the day of ova pick up:

Results of real-time PCR quantification of ACT A gene expression are shown in table (7 and 8). The mean ΔCt value of ACT A for Non- the PCOS group was 14.95±3.45 on the ova pick-up day. While it was 15.82±3.11 in PCOS. The fold of gene expression in the non-PCOS group decreased by(0.85) compared to the PCOS group. The mean ΔCt value of ACT A for the Non-PCOS group was 16.24±2.04 on embryo transfer day. While it was 18.01±2.76 in PCOS. The fold of gene expression in the non-PCOS group decreased by(2.41) compared to the PCOS group.

Table 7: Comparison of ACT A expression between PCOS and Non-PCOS groups on the day of oval pickup

Characteristic	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
	ET		OPU
	Mean±SD
Non-PCOS	16.24±2.04^a	N.S.	1.77	0.293	2.41
(n =14)		0.0774
PCOS	18.01±2.76^a
(n =14)

Table 8: Comparison of ACT A expression between PCOS and Non-PCOS groups on the day of ET

Characteristic	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
	OPU		OPU
	Mean±SD
Non-PCOS	14.95±3.45^a	N.S.	0.87	0.54	0.85
(n =14)		0.5233
PCOS	15.82±3.11^a
(n =14)

Comparison of FBN-3 expression between PCOS and Non-PCOS groups:

Results of real-time PCR quantification of FBN-3 gene expression are shown in table (9 and 10). The mean ΔCt value of FBN-3 for the Non-PCOS group was 16.90±4.78 at ova pick up. While it was16.03±4.39 in PCOS. The fold of gene expression in the PCOS group increased by (0.26) compared to the non-PCOS group.. And the mean ΔCt value of FBN-3 for the Non-PCOS group was 13.07±4.50 after 14 days of embryo transfer. While it was 12.81±4.46 in PCOS. The fold of gene expression in the non-PCOS group increased by(0.19) compared to the PCOS group. There was no statistical difference between divided groups in this study

Table 9: Comparison of FBN-3 expression between PCOS and Non-PCOS groups at ova pick up day

Characteristic	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
	OPU		OPU
	Mean±SD
Non-PCOS	16.90±4.78^a	N.S.	-0.34	1.26	0.26
(n =14 )		0.6291
PCOS	16.03±4.39^a
(n =14 )

Table 10: Comparison of FBN-3 expression between PCOS and Non-PCOS groups on the day of ET

Characteristic	ΔCT	P-value	ΔΔ CT	2^{– ΔΔCT}	Fold of gene expression
	ET		OPU
	Mean±SD
Non-PCOS	13.07±4.50^a	N.S.	-0.26	1.19	0.19
(n =14)		0.8849
PCOS	12.81±4.46^a
(n =14 )

DISCUSSION:

The expression of ACT A gene on the day of ova pick up was highly significant in pregnancy compared with the non-pregnancy group p-value (0.0066, 0.0124) for non-PCOS and PCOS women respectively, and decrease the expression after 14 days of embryo transfer for pregnancy in both PCOS and non-PCOS, while the expression was increased for non-pregnancy in non-PCOS and PCOS women, no statistical difference between pregnancy and non-pregnancy at the day of ET in non-PCOS and PCOS groups. Activin-A and activin receptor protein and mRNA expression in the ovary have been found in both oocytes and granulosa cells of follicles at various developmental stages. All follicular compartments, including the oocyte, cumulus cells, mural granulosa cells, and thecal cells, had a moderate to a strong reaction to both activin-A and follistatin during the antral stages^18,19.

Activin also inhibited androgen production in different species of theca cells^20,21. As a result, activin is thought to play a key role in antral follicle recruitment and selection by stimulating proliferation and FSH receptor expression in granulosa cells, as well as modulating steroidogenesis in granulosa and theca cells. Its actions are time and concentration-dependent and are regulated by follistatin^22,23. In several species, Activin-A is also involved in the regulation of oocyte maturation^24;25. The distribution of activin-A, its binding protein follistatin, and activin receptors in goat antral follicles suggests that these proteins play an important role in this species' antral follicle development.

We believed that the ratio of follistatin to activin A, and not just the absolute activin concentration, was the main player in the pathogenesis of PCOS and that the high follistatin to activin A ratio, as stated by^26-28, is the one that should be blamed because follistatin will bind and deactivate activin A and will not reduce its level.

In the luteal phase of pregnant women, a further reduction of this hormone has occurred in both protocols. While it raises again in the late luteal phase if the woman was not pregnant.

At the luteal phase, there was a highly significant difference between pregnant and non-pregnant for both PCOS and non- PCOS groups, the activin-A level was higher in the non-pregnant compared to the pregnant because activin-A was suppressed in early pregnancy by hCG and thus corpora-luteal function can continue and the pregnancy be maintained²⁹.

The expression of FBN-3 gene on the day of ova pick up was high in non-pregnancy compared with pregnancy group for non-PCOS and PCOS women but not statistical deferent, while decreasing the expression after 14 days of embryo transfer in non-pregnancy compared with pregnancy for both PCOS and non-PCOS, and there were no statistical differences between divided groups in this study.

In general, during this study, FBN-3 expression raise in the mid-cycle compared with the luteal phase for both pregnant and non-pregnant PCOS and non- PCOS women which is confirmed by the findings of Al-Dujaily and Mohammed 2014³⁰ which found an increase of this hormone level at preovulatory stage of the non-IVF cycle then the level was decreased following 14 days post ovulation.

Fibrillin-3 was identified in a very restricted distribution within an adult human ovary, and it was localized in the stroma immediately adjacent to a minor subset of TFs. Fibrillin-3 staining was most dense in such areas of specialized perifollicular stroma, A few of the TFs with fibrillin-3 staining do not contain observable oocytes, which could indicate barren follicles. There was no staining for fibrillin-3 outside of the regions of specialized perifollicular stroma, except in senescent ovaries, where small foci of cortical stroma with the appearance of specialized perifollicular stroma show staining for fibrillin-3. There was no fibrillin-3 staining associated with maturing antral follicles³¹.

CONCLUSION:

1. Act A expression in PCOS women higher than in healthy women.

2. Act A considered a good predictor for the detection of pregnancy

3. There was no significant difference in the expression of FBN-3 between PCOS and non-PCOS.

4. The level of FNB-3expression was slightly increased in non-PCOS than in PCOS.

REFERENCES:

1. Implantation stages. Human Embryology. Online course in embryology for medicine students developed by the universities of Fribourg, Lausanne and Bern (Switzerland) with the support of the Swiss Virtual Campus. Retrieved 6 December, 2011.

2. Azziz R, Carmina E, Chen Z, Dunaif A, Laven JS, Legro RS, et al. Polycystic ovary syndrome. Nat Rev Dis Primers. 2016; 2: 16057.2.

3. Anuchithra Radhakrishnan S. Polycystic Ovarian Syndrome (PCOS) in Adolescence. Asian J. Nur. Edu. and Research 2012; 2(2): 55-64.

4. Asha K Varughese, Veena Greetta Tauro. Polycystic Ovarian Syndrome – An Overview. Int. J. Nur. Edu. and Research. 2019; 7(4): 601-604.

5. Veena Kirthika. S, Himabindu Daggumati, Padmanabhan. K, Jibi Paul, Selvaraj Sudhakar, Senthil Selvam. P. Effect of Structured Awareness Programme on Polycystic Ovarian Syndrome (PCOS) among Adolescent Girls. Research J. Pharm. and Tech. 2019; 12(12): 6097-6100.

6. Savita Vashist, Lavanya Nandan, Jony Sharma. A Study to Evaluate the effectiveness of Structured Teaching Programme on knowledge regarding of Polycystic Ovarian Syndrome among School teachers of selected school of Ghaziabad. Int. J. Nur. Edu. and Research. 2020; 8(2):195-201.

7. Asha K Varughese, Veena Greetta Tauro. Effectiveness of Structured Teaching Programme (STP) on Knowledge regarding Polycystic Ovarian Syndrome (PCOS) among Adolescent Girls, Kollam. Int. J. Nur. Edu. and Research. 2018; 6(4):360-362.

8. Neha Parmar, Munshi Ruzda Khanam, Patel Moshmi, Panchal Shruti, Goyara Krishna, Christian Brinky, Ninama Nidhi. A Study to assess The Effectiveness of Planned Teaching Programme on knowledge regarding Polycystic Ovarian Syndrome among Adolescent Girls in Selected Colleges at Nadiad City, Gujarat State. Int. J. of Advances in Nur. Management. 2019; 7(1):06-08.

9. Choragudi Srujana, Rayapu Vasundhara, Jonnalagadda Miryani. A Study To Assess The Knowledge Of Nursing College Students Regarding Polycystic Ovarian Syndrome In Selected College At Guntur District, Andhra Pradesh. Int. J. of Advances in Nur. Management. 2018; 6(3): 210-214.

10. Anitharajendrababu, Mini Abraham. Effectiveness of Planned Teaching Programme regarding Polycystic Ovarian Disease among Adolescent Girls. Int. J. Adv. Nur. Management. 2017; 5(2):143-145.

11. Santhipriya Monterio, Anusree G, Anusree. K. T, Arya Prasad N. T, RojaTom, Leethu David, Rasheeda Gopal, et. al. A Study to assess the effectiveness of Structured Teaching Programme regarding knowledge on Polycystic ovarian syndrome among the adolescents of selected PU College in Mangaluru. Asian J. Nursing Education and Research. 2021; 11(2):213-216.

12. Haneen Subhee Shaheed, Suzan Yousif Jasim, Wassan Abdul-Kareem Abbass. Studying Some Novel Biochemical and Immunological Markers in a Sample of Iraqi Women with Polycystic Ovarian Syndrome. Research J. Pharm. and Tech. 2020; 13(7): 3171-3178.

13. Fortin J, Boehm U, Deng C-X, Treier M, Bernard DJ. Follicle-stimulating hormone synthesis and fertility depend on SMAD4 and FOXL2. The FASEB Journal. 2014; 28(8):3396-3410.

14. Shaw ND, Histed SN, Srouji SS, Yang J, Lee H, Hall JE. Estrogen Negative Feedback on Gonadotropin Secretion: Evidence for a Direct Pituitary Effect in Women. The Journal of Clinical Endocrinology and Metabolism. 2010; 95(4):1955-1961.

15. Rozario T. and De Simone DW, et al. The extracellular matrix in development and morphogenesis: a dynamic view.Dev.Biol. 2010; 341:126-140.

16. Ramirez F, Sakai LY. Biogenesis and function of fibrillin assemblies. Cell Tissue Res. 2010; 339:71-82.

17. Fatemi HM, Polyzos NP, Van Vaerenbergh I, et al. Early luteal phase endocrine profile is affected by the mode of triggering final oocyte maturation and the luteal phase support used in recombinant follicle-stimulating hormone-gonadotropin-releasing hormone antagonist in vitro fertilization cycles. Fertil Steril. 2013; 100:742-7.

18. Wu TC, Jih MH, Wang L and Wan YJ Expression of activin receptor II and IIB mRNA isoforms in mouse reproductive organs and oocytes. Molecular Reproduction and Development. 1994; 38: 9–15.

19. Zhao J, Taverne MA, van der Weijden GC, Bevers MM and van den Hurk R. Effect of activin A on in vitro development of rat preantral follicles and localisation of activin A and activin receptor II. Biology of Reproduction. 2001; 65: 967–977.

20. Hillier SG, Yong EL, Illingworth PJ, Baird DT, Schwall RH and Mason AJ Effect of recombinant activin on androgen synthesis in cultured human thecal cells. Journal of Clinical Endocrinology and Metabolism. 1991; 72: 1206–1211.

21. Campbell BK and Baird DT Inhibin A is a follicle stimulating hormone-responsive marker of granulosa cell differentiation, which has both autocrine and paracrine actions in sheep. Journal of Endocrinology 2001; 169: 333–345.

22. Findlay JK An update on the roles of inhibin, activin, and follistatin as local regulators of folliculogenesis. Biology of Reproduction 1993; 48: 15–23.

23. Findlay JK, Drummond AE, Dyson ML, Baillie AJ, Robertson DM and Ethier JF Recruitment and development of the follicle; the roles of the transforming growth factor-beta superfamily. Molecular and Cellular Endocrinology 2002; 191: 35–43.

24. Silva CC and Knight PG Modulatory actions of activin-A and follistatin on the developmental competence of in vitro-matured bovine oocytes. Biology of Reproduction 1998; 58: 558–565.

25. Alak BM, Coskun S, Friedman CI, Kennard EA, Kim MH and Seifer DB Activin A stimulates meiotic maturation of human oocytes and modulates granulosa cell steroidogenesis in vitro. Fertility and Sterility 1998; 70: 1126–1130.

26. Teede H, Ng S, Hedger M, Moran L. Follistatin and activins in polycystic ovary syndrome: relationship to metabolic and hormonal markers. Metabolism. 2013; 62(10):1394-400.

27. O’Connor AE, McFarlane JR, Hayward S. Serum activin A and follistatin concentrations during human pregnancy: a cross-sectional and longitudinal study.Human Reproduction. 1999; 14: 827–832.

28. Qiao J, Feng HL. Extra- and intra-ovarian factors in polycystic ovary syndrome: impact on oocyte maturation and embryo developmental competence. Human Reproduction Update. 2011; 17(1): 17-33.

29. Lockwood GM, Muttukrishna S and Ledger W. Inhibins and activins in human ovulation,conception and pregnancy.Hum Reprod Update. 1998; 4 (3): 284-295.

30. Al-Dujaily SS, Mohammed W. Role of fibrillin-3 in fertilization capacity in women undergoing intrauterine insemination. IJEIR. 2014; 6(2):34-39.

31. Diana Jordan C., Sandra D. Bohling, Noe L. Charbonneau, Lynn Y. Sakai First Fibrillins in Adult Human Ovary and Polycystic Ovary Syndrome: Is Fibrillin-3 Affected in PCOS? Research Article Find in PubMed. 2010; https://doi.org/10.1369/jhc.2010.956615

Received on 20.11.2021 Modified on 27.05.2022

Research J. Pharm. and Tech 2023; 16(10):4891-4896.

DOI: 10.52711/0974-360X.2023.00793